logo1

logoT

 

Fwd перевод


Перевод АНГЛИЙСКОГО слова Fwd

Fwd по-ФРАНЦУЗСКИ toward the front; ahead; to the front

Источник для словаря: Babylon English-English
Больше: Перевод fwd с английский на английский

Fwd по-ФРАНЦУЗСКИ إلى الأمام

Источник для словаря: Babylon English-Arabic Dictionary
Больше: Перевод fwd с английский на Арабский

Fwd по-ФРАНЦУЗСКИ adelante; hacia adelante; delante

Источник для словаря: Babylon English-Spanish Dictionary
Больше: Перевод fwd с английский на испанский

Fwd по-ФРАНЦУЗСКИ voorwaarts; vooruit; naar voren

Источник для словаря: Babylon English-Dutch Dictionary
Больше: Перевод fwd с английский на голландский

Fwd по-ФРАНЦУЗСКИ à frente, adiante

Источник для словаря: Babylon English-Portuguese Dictionary
Больше: Перевод fwd с английский на португальский

Fwd по-ФРАНЦУЗСКИ öne, ileriye doğru; ileri; cepheye doğru

Источник для словаря: Babylon English-Turkish Dictionary
Больше: Перевод fwd с английский на турецкий

Fwd по-ФРАНЦУЗСКИ avanti; innanzi; in evidenza, in rilievo; (Mar) verso prua, a proravia

Источник для словаря: Babylon English-Italian Dictionary
Больше: Перевод fwd с английский на итальянский

Fwd по-ФРАНЦУЗСКИ en avant; en têten, de l'avant

Источник для словаря: Babylon English-French Dictionary
Больше: Перевод fwd с английский на французский

Fwd по-ФРАНЦУЗСКИ vorwärts; geradeaus; weiter

Источник для словаря: Babylon English-German Dictionary
Больше: Перевод fwd с английский на Немецкий

Fwd по-ФРАНЦУЗСКИ 前方へ; 先へ; 前へ

Источник для словаря: Babylon English-Japanese Dictionary
Больше: Перевод fwd с английский на японский

Fwd по-ФРАНЦУЗСКИ קדימה; הלאה; לפנים

Источник для словаря: Babylon English-Hebrew Dictionary
Больше: Перевод fwd с английский на Иврит

Больше языков:

[top] Fwd по-ФРАНЦУЗСКИ 1 Front Wheel Drive [SAE J1930]2 Four Wheel Drive [USA]

Источник для словаря: Automotive Acronyms
Больше: Перевод fwd с английский на английский

forward

Источник для словаря: maritime&shipping™
Больше: Перевод fwd с английский на английский

Forward

Источник для словаря: AERONAUTICAL ABBREVIATIONS
Больше: Перевод fwd с английский на английский

FWD may refer to:
  • Front-wheel drive, a common method of vehicle propulsion
  • FWD (Famine, War, and Drought), Campaign from USAID
  • Free World Dialup (now simply FWD), a non-commercial Voice over IP network
  • Falling weight deflectometer (Falling Weight Deflectometer test), a structural test on road and airport pavements
  • Far Western District, a geographical district of the Barbershop Harmony Society
  • Fear the Walking Dead
  • Fire weather outlook, a forecast of fire weather conditions by the U.S. National Weather Service
  • An archaic term for four-wheel drive (4WD or AWD is preferred today)
  • The Four Wheel Drive Auto Company of Clintonville, Wisconsin, later the FWD Corporation
  • An abbreviation of "Forward", appended to the beginning of e-mail subject lines when sending a received message on to someone else ("forwarding")
  • FWD.us, a lobbying group in the United States founded by Silicon Valley entrepreneurs (led by Mark Zuckerberg), focused on immigration reform and improving education and enabling technological breakthrough.
  • Free Working Distance, a term used in microscopy to describe the distance between the focused object and the objective lens

See more at Wikipedia.org...

Копирайт: © This article uses material from Wikipedia® and is licensed under the GNU Free Documentation License and under the Creative Commons Attribution-ShareAlike License Источник для словаря: Wikipedia English - The Free Encyclopedia
Больше: Перевод fwd с английский на английский

Forward

Источник для словаря: International Relations and Security Acronyms
Больше: Перевод fwd с английский на английский

forward
  

Копирайт: Source: U.S. Department of Defense, Joint Doctrine Division. ( About ) Источник для словаря: DOD Joint Acronyms and Abbreviations
Больше: Перевод fwd с английский на английский

Forward

Источник для словаря: Abbreviation Airbus A340
Больше: Перевод fwd с английский на английский

Fwd по-ФРАНЦУЗСКИ FWHP 开井井口流压

Источник для словаря: 专业字典 English Chinese Dictionary
Больше: Перевод fwd с английский на китайский (s)

Fwd по-ФРАНЦУЗСКИ tracción delantera

Источник для словаря: English_Spanish by Jaime Aguirre
Больше: Перевод fwd с английский на испанский

Fwd по-ФРАНЦУЗСКИ f.w.d. - повреждение пресной водой

Копирайт: Источник для словаря: English-Russian Insurance Dictionary
Больше: Перевод fwd с английский на русский

Fwd по-ФРАНЦУЗСКИ (TOEFL)
1. forward

Источник для словаря: English - Thai Dictionary (Loy)
Больше: Перевод fwd с английский на тайский

Fwd по-ФРАНЦУЗСКИ abrev forward

Источник для словаря: English Catalan Dictionary
Больше: Перевод fwd с английский на каталанский

Fwd по-ФРАНЦУЗСКИ abbr = forward fwy (US )abbr = freeway

Источник для словаря: English Polish Dictionary (Gold)
Больше: Перевод fwd с английский на польский

Fwd по-ФРАНЦУЗСКИ fwd abbr forward.

Источник для словаря: English French Dictionary (Kelkouli Rédha)
Больше: Перевод fwd с английский на французский

Fwd по-ФРАНЦУЗСКИ előre

Источник для словаря: English-Hungarian Dictionary (Száraz)
Больше: Перевод fwd с английский на венгерский


определение и синонимы слова f.w.d. в словаре английский языка

F.W.D. - определение и синонимы слова f.w.d. в словаре английский языка

Educalingo использует cookies для персонализации рекламы и получения статистики по использованию веб-трафика. Мы также передаем информацию об использовании сайта в нашу социальную сеть, партнерам по рекламе и аналитике.

ПРОИЗНОШЕНИЕ СЛОВА F.W.D.

ЧТО ОЗНАЧАЕТ СЛОВО F.W.D.

Нажмите, чтобы посмотреть исходное определение слова «f.w.d.» в словаре английский языка. Нажмите, чтобы посмотреть автоматический перевод определения на русский языке.
Значение слова f.w.d. в словаре английский языка
Определение f.w.d. в словаре есть полноприводный. Другое определение f.w.d. передний привод.

The definition of f.w.d. in the dictionary is four-wheel drive. Other definition of f.w.d. is front-wheel drive.


Нажмите, чтобы посмотреть исходное определение слова «f.w.d.» в словаре английский языка. Нажмите, чтобы посмотреть автоматический перевод определения на русский языке.

Синонимы и антонимы слова f.w.d. в словаре английский языка

Перевод слова «f.w.d.» на 25 языков

ПЕРЕВОД СЛОВА F.W.D.

Посмотрите перевод слова f.w.d. на 25 языков с помощью нашего многоязыкового переводчика c английский языка. Переводы слова f.w.d. с английский языка на другие языки, представленные в этом разделе, были выполнены с помощью автоматического перевода, в котором главным элементом перевода является слово «f.w.d.» на английский языке.
Переводчик с английский языка на китайский язык
f.w.d.

1,325 миллионов дикторов

Переводчик с английский языка на испанский язык
f.w.d.

570 миллионов дикторов

английский
f.w.d.

510 миллионов дикторов

Переводчик с английский языка на хинди язык
f.w.d.

380 миллионов дикторов

Переводчик с английский языка на арабский язык
f.w.d.

280 миллионов дикторов

Переводчик с английский языка на русский язык
f.w.d.

278 миллионов дикторов

Переводчик с английский языка на португальский язык
f.w.d.

270 миллионов дикторов

Переводчик с английский языка на бенгальский язык
f.w.d.

260 миллионов дикторов

Переводчик с английский языка на французский язык
f.w.d.

220 миллионов дикторов

Переводчик с английский языка на малайский язык
F.w.d.

190 миллионов дикторов

Переводчик с английский языка на немецкий язык
f.w.d.

180 миллионов дикторов

Переводчик с английский языка на японский язык
f.w.d.

130 миллионов дикторов

Переводчик с английский языка на корейский язык
f.w.d.

85 миллионов дикторов

Переводчик с английский языка на яванский язык
F.w.d.

85 миллионов дикторов

Переводчик с английский языка на вьетнамский язык
f.w.d.

80 миллионов дикторов

Переводчик с английский языка на тамильский язык
f.w.d.

75 миллионов дикторов

Переводчик с английский языка на маратхи язык
F.w.d.

75 миллионов дикторов

Переводчик с английский языка на турецкий язык
f.w.d.

70 миллионов дикторов

Переводчик с английский языка на итальянский язык
f.w.d.

65 миллионов дикторов

Переводчик с английский языка на польский язык
f.w.d.

50 миллионов дикторов

Переводчик с английский языка на украинский язык
f.w.d.

40 миллионов дикторов

Переводчик с английский языка на румынский язык
f.w.d.

30 миллионов дикторов

Переводчик с английский языка на греческий язык
f.w.d.

15 миллионов дикторов

Переводчик с английский языка на африкаанс язык
f.w.d.

14 миллионов дикторов

Переводчик с английский языка на шведский язык
f.w.d.

10 миллионов дикторов

Переводчик с английский языка на норвежский язык
f.w.d.

5 миллионов дикторов

Тенденции использования слова f.w.d.

ТЕНДЕНЦИИ ИСПОЛЬЗОВАНИЯ ТЕРМИНА «F.W.D.»

ЧАСТОТНОСТЬ

Слово используется очень часто

На показанной выше карте показана частотность использования термина «f.w.d.» в разных странах. Тенденции основных поисковых запросов и примеры использования слова f.w.d. Список основных поисковых запросов, которые пользователи ввели для доступа к нашему онлайн-словарю английский языка и наиболее часто используемые выражения со словом «f.w.d.».

ЧАСТОТА ИСПОЛЬЗОВАНИЯ ТЕРМИНА «F.W.D.» С ТЕЧЕНИЕМ ВРЕМЕНИ

На графике показано годовое изменение частотности использования слова «f.w.d.» за последние 500 лет. Формирование графика основано на анализе того, насколько часто термин «f.w.d.» появляется в оцифрованных печатных источниках на английский языке, начиная с 1500 года до настоящего времени.

Примеры использования в литературе на английский языке, цитаты и новости о слове f.w.d.

КНИГИ НА АНГЛИЙСКИЙ ЯЗЫКЕ, ИМЕЮЩЕЕ ОТНОШЕНИЕ К СЛОВУ «F.W.D.»

Поиск случаев использования слова f.w.d. в следующих библиографических источниках. Книги, относящиеся к слову f.w.d., и краткие выдержки из этих книг для получения представления о контексте использования этого слова в литературе на английский языке.

1

Fluorescence Microscopy

The first volume deals with instrumentation and techniques for fluorescence microscopy, and includes a chapter on quantification and scanning. The second volume deals with the applications of fluorescence microscopy in many fields.

2

Quantitative Fluorescence Microscopy

This book is a complete guide to this technique for all biologists. It describes the principles and applications of quantitative fluorescence microscopy and also gives much practical information about the instrumentation required.

3

American Military Vehicles of World War I: An Illustrated ...

Meanwhile, since the American military brass were still experimenting, FWD had to find its own civilian markets to continue its tentative existence. No assembly line meant that FWD cars and trucks were hand-built one by one, resulting in a ...

4

EMAILS Fwd:FW:: The Difference

The Difference Gerry Gialogo Grindulo. 0'. I 'I . - 1 ' ' . ' I P l A 0 I I I 1 J ,_ 1' ' 9 . n I O O O i '. ' .0 ' . O o O .0 I o O ' .oze..... '7'} .5. TDifference COMMUNICATION GENERATION EMAILS Fwd: FW: THE DIFFERENCE COMMUNICATION ...

Gerry Gialogo Grindulo, 2010

5

Nondestructive Testing of Pavements and Backcalculation of ...

A device for this purpose is sold by the FWD manufacturer. With periodic calibration of the geophones, using an external, independent reference instrumentation system, the systematic error of each deflection sensor can generally be much ...

Albert Jasper Bush, Gilbert Y. Baladi, 1989

6

IBM Flex System and PureFlex System Network Implementation ...

+ FWD DESG 807e-08:17:f4:33:75:00 8440 P2P 2 (pc65) 128 115!+ FWD DESG 807e-08:17:f4:33:75:00 8440 P2P 3 (pc65) 128 115!+ FWD DESG 807e-08:17:f4: 33:75:00 8440 P2P 4 (pc65) 128 115!+ FWD DESG 807e-08:17:f4:33:75:00 ...

Jon Tate, Jure Arzensek, David Cain, 2013

7

Resilient Modulus Testing for Pavement Components

Falling Weight Deflectometer Tests Falling weight deflectometer (FWD) tests were performed at STH 60 to determine the operative elastic moduli of the Grade 2 subbase, bottom ash, and foundry slag. The FWD tests were conducted ...

Gary N. Durham, W. Allen Marr, William L. DeGroff, 2003

8

Molecular Genetics of Dorsal Spine Reduction in Threespine ...

Table 3-9: Microsatellite Markers Primer Name Sequence Stn42 fwd ACACGCAGCTTGACTGTTCC Stn42 rev GCGTATACGTTACACGCCG Stn45 fwd ACGAGGGTTTGAGTCTCTCC Stn45 rev GTTGTTCAATCCATCCGTCC Stn365 fwd ...

Brian Russell Summers, 2008

9

Nondestructive Testing of Pavements and Backcalculation of ...

Consistent placement of the FWD measurement system should be followed, and the placement geometry should be documented. 2. Normalize the measured deflections to a standard FWD load level (e.g., 9000 Ib [40 kN|), and calculate the  ...

Harold L. Von Quintus, Albert Jasper Bush, Gilbert Y. Baladi, 1994

Maker or Seller Name & Model Hp Transmission type Speed range Impl. lift Wt. ( Ib.) Comments Max. cut ALLIS- CHALMERS 720 19.5 Hydro plus 3-spd. ltd. slip differ. Hydro; ltd. slip. Hydro; ltd. slip. Shuttle Gear Gear Gear 3 ranges, fwd. & rev.


ССЫЛКИ

« EDUCALINGO. F.w.d. [онлайн]. Доступно на <https://educalingo.com/ru/dic-en/fwd>. Дек 2021 ».

[ncc-moscow04] RIPE NCC Russian draft documents (fwd)

Re: [ncc-moscow04] RIPE NCC Russian draft documents (fwd) RIPE NCC Mail Archives

Здравствуйте, Есть несколько вопросов. В Договоре написано: 8.1 Типовой договор об оказании услуг RIPE NCC заключается на неопределенный срок и может быть расторгнут любой из сторон, при условии уведомления об этом не менее чем за три месяца. Банки не любят неопределенных сроков. Можно ли оформить в Договоре сроки след. образом: Договор заключается на 1 год. Если Стороны не предприняли усилий по его разрыву, Договор продляется/пролонгируется на следующий год? Возможно, фраза кривая, но смысл такой. Также есть вопрос по поводу схемы оплаты - хотелось бы увидеть фразу в таком ключе: оплата на год составляет <такую-то_сумму>. Далее, при изменении статуса LIRа можно ввести доп. соглашение или заключить новый Договор. Заранее благодарен. Thursday, December 2, 2004, 13:52, you wrote: LAY> Добрый день! LAY> Привожу перевод письма LAY> Date: Thu, 02 Dec 2004 11:06:49 +0100 LAY> From: Jochem de Ruig [email protected] LAY> LAY> Subject: [ncc-moscow04] RIPE NCC Russian draft documents LAY> --------------------------------------------- LAY> Уважаемые коллеги, LAY> следуя предложению RIPE NCC от 9 ноября, мы подготовили LAY> следующие документы: LAY> - перевод Типового договора (the Standard Service Agreement) LAY> - перевод документа "Типовые положения и условия RIPE NCC" LAY> (the Terms and Conditions) LAY> - образец Счета (Invoice) LAY> - дополнительное Соглашение об оказании услуг, относящееся к Счету LAY> - Акт сдачи-приемки LAY> Документы опубликованы здесь: LAY> http://www.ripe.net/meetings/regional/moscow-2004/contracts/ LAY> Одно замечание: мы предлагаем сделать формулировку услуг более простой LAY> и более общей: "предоставление Интернет-ресурсов", без уточнений LAY> (IPv4, IPv6 and AS numbers). LAY> Просим вас высказать свое мнение относительно этих документов. LAY> Нам необходимо начать приготовления к выставлению счетов LAY> за 1 квартал 2005 г. и к перезаключению Договора. LAY> С наилучшими пожеланиями, LAY> Jochem de Ruig LAY> финансовый директор LAY> RIPE NCC LAY> ------------------------------------------- LAY> Dear colleagues, LAY> Following from the RIPE NCC proposal on 9 November we prepared the LAY> following documents: LAY> - A translation of the Standard Service Agreement LAY> - A translation of the Terms and Conditions LAY> - An invoice template LAY> - An additional Service Agreement related to the invoice LAY> - An additional Act of Acceptance related to the invoice LAY> The documents can be found at: LAY> http://www.ripe.net/meetings/regional/moscow-2004/contracts/ LAY> One additional comment: our proposal is to keep the service description LAY> simple and generic LAY> by stating "provision of Internet Resources". This is contrary to suggestions LAY> to specify the resources per category (IPv4, IPv6 and AS numbers). LAY> Please let us know what your view is regarding the documents. We need to LAY> start preparations LAY> for the initial quarterly invoices for 2005 and for the re-signing of the LAY> RIPE NCC Standard Service LAY> Agreement. LAY> Kind regards, LAY> Jochem de Ruig LAY> Chief Financial Officer LAY> RIPE NCC -- With best regards, ________________________________________ Dmitry Safronov Zenon N.S.P. Tel. +7(095) 956-4035, +7(812) 326-4468 Fax. +7(095) 251-5702 

Какой привод лучше - FWD, RWD или AWD?

Дата: 3 июля 2018 г.

Привод автомобиля можно сказать самая важная из его характеристик. При выборе себе автомобиля вы теряетесь и не знаете какой же привод выбрать и чем они друг от друга отличаются. Давайте вместе разберемся какой выбор будет лучше для вас и рассмотрим все плюсы и минусы этих трех систем привода автомобиля.

Передний привод FWD

Передний привод (Front-Wheel Drive) – это когда тяга от двигателя передается только на передние два колеса. Обладает двумя основными преимуществами как для производителей, так и для автовладельцев. Первое преимущество заключается в том, что его дизайн и сборка становится дешевле в производстве, так как весь приводной механизм находится внутри моторного отсека, как следствие меньше движущихся частей. Расход топлива экономичней примерно на 7% в сравнении с задним приводом. Сам двигатель и трансмиссия находится в одном месте у автомобиля, в отличие от автомобиля с приводом на задние колеса (RWD). В управлении передний привод намного легче, такой автомобиль труднее уходит в занос. Если вы покупаете свой первый автомобиль, то берите как раз переднеприводной.

Другим преимуществом переднего привода является то, что у передних колес лучшее сцепление с дорожным покрытием – особенно в дождь и снег. На передние колеса, которые тянут автомобиль. приходится вес тяжелого двигателя и коробки передач. Этот вес дополнительно действует на сцепление с дорогой, что ведет к высокой курсовой устойчивости автомобиля, чем у заднеприводного, особенно в плохих погодных условиях.

Недостатки? Автомобили с передним приводом склонны к недостаточной поворачиваемостью. Т.к. передние колеса выполняю одновременно две функции – управление автомобилем т.е. руление и непосредственное движение авто т.е. тяга автомобиля. При этом задние колеса практически в управлении автомобилем не участвуют. Также в высокомощном переднеприводном автомобиле крутящий момент, передающийся от двигателя на передние колеса, мешает лучше чувствовать руль.

Задний привод RWD

Задний привод (Rear-Wheel Drive) – это когда тяга от двигателя передается только на задние колеса. Они вращаясь толкают автомобиль вперед.

Вот основные преимущества автомобиля с задним приводом. Во-первых, более прост и надежен. У вас есть двигатель спереди, коробка передач посередине и ведущая ось сзади, а передняя — поворачивает. На таком автомобиле лучше чувствуется руль, привод не влияет на рулевое управление. Такие авто имеют преимущество при разгоне и имеют контролируемый занос задней оси. Большинство спортивных и гоночных автомобилей являются заднеприводными.

Недостатки? Автомобили RWD более громоздки и дороже в производстве. Как следствие обладают более высокой розничной ценой. Карданный тоннель «съедает» полезную площадь салона автомобиля. Для трех пассажиров на заднем сиденье уже будет мало места.

Полный привод AWD

В таком автомобиле трансмиссия передает вращающий момент на все четыре колеса, от чего существенно улучшается проходимость. Теоретически автомобиль с полным приводом (All-Wheel Drive) дает вам некоторые преимущества над автомобилями с приводом на задние колеса (RWD) и на передние (FWD), при этом минимизируя все слабые стороны обоих систем.

Самое большое преимущество AWD — отличная тяга. Будь то влажное или сухое дорожное покрытие, на асфальтированной дороге или гравии – у полноприводного автомобиля будет гораздо выше уровень сцепления. Вот почему когда-то полный привод применялся только на вездеходах.

Но, неизбежно, есть недостатки! Два самых больших — вес и стоимость. Автомобили AWD могут весить на сотни килограммов больше, чем автомобили с одинаковым размером FWD или RWD, и это влияет на показатели ускорения и экономии топлива автомобиля. Другим недостатком является дополнительная сложность и стоимость, связанные с установкой AWD. Имеется больше компонентов и узлов, которые требуют обслуживания, а это значит, что стоимость содержания такого авто будет выше.

Итак, какой же из них вам подходит?

Как вы можете видеть, нет простого ответа, какой тип привода лучше всего подходит для вас. Тип привода, который подходит вам, зависит от того, как именно автомобиль вы используете, в каких условиях вы обычно ездите, а также от того, что вы ожидаете в целом от автомобиля.

Если вы за семейный автомобиль, который будет ездить в основном по хорошим дорогам — передний привод FWD будет более чем достаточным. Если вы хотите спортивный, более сбалансированный автомобиль, автомобиль с задним приводом RWD может быть лучшим выбором. Или, если вы хотите хорошую проходимость, независимо от условий и не бойтесь заплатить немного больше, вы, вероятно, должны смотреть на автомобиль с полным приводом AWD.


ПОМНИТЕ: Вы всегда можете обратиться в наш автосервис, где Вашему автомобилю с радостью окажут профессиональную техническую помощь. Также Вы можете записаться к нам на плановый технический осмотр! Ознакомитесь пожалуйста с нашими услугами по ремонту и диагностике автомобиля.

Multitran dictionary

English-Russian forum   EnglishGermanFrenchSpanishItalianDutchEstonianLatvianAfrikaansEsperantoKalmyk ⚡ Forum rules
✎ New thread | Private message Name Date
3 43  shin washer  ochernen  5.12.2021  0:56
56  Просто классный ролик - посмеяться на выходные  niccolo  4.12.2021  23:16
3 146  Waiver  LordBEleth  1.12.2021  21:30
4 102  Ордер адвоката  Garbuziabr  1.12.2021  22:43
4 75  Radial/Anti-Radial  adelaida  4.12.2021  0:42
14 203  Carrington elevators  ochernen  2.12.2021  11:27
19 577  Где послушать произношение  Susan  19.11.2021  14:07
85  Свидетельство о браке  Larisochka  3.12.2021  19:29
4 97  Помогите перевести / OSA Original Side Appeal , CMP Civil Miscellaneous Petition  fddhhdot  3.12.2021  18:13
7 106  services implement specifications  Miche  3.12.2021  12:53
60 1296  Транскрипция  | 1 2 all aksa  12.11.2021  23:21
1 46  "Spin-down" в анализаторе ДНК, РНК и протеинов  Greenbird  3.12.2021  16:57
1 107  Помощь  Андрес  3.12.2021  13:26
9 206  Что такое thread shave? резьба  stein_vik  1.12.2021  12:44
597 19106  Проблемы в работе нового сайта  | 1 2 3 4 5 6 7 8 9 10 11 12 13 all 4uzhoj  15.05.2019  11:05
2 81  Справка о наследстве  fontana  3.12.2021  8:28
4 138  Keep your business healthy and stable to support sustainable growth  A111981  2.12.2021  16:21
29 1282  Отдам словари в хорошие руки бесплатно.  10-4  15.10.2021  14:36
4 77  Тягач в контексте горно-шахтного оборудования  denghu  2.12.2021  16:34
5 131  Bill of lading  hrustalik  2.12.2021  16:50
99 9041  Быстрые ссылки на онлайн-ресурсы в словаре  | 1 2 all 4uzhoj  17.12.2019  17:49
4 350  OFF: БП Smartling  Alex_Odeychuk  1.12.2021  18:31
6 129  Дизельный двигатель  Senja  1.12.2021  16:53
6 155  you’ll change Помогите понять смысл фразы пожалуйста :)  ochernen  1.12.2021  14:46
44 660  Слово года / Word of the Year 2021 - вакцина/vaccine  Себастьян Перейра, торговец...  29.11.2021  10:51
3 139  Пробив по базам  Novosedoff  1.12.2021  0:13
5 272  OFF: Стрижка "под Канадку".  Alex1888  1.12.2021  14:31
17 828  MTA ищет переводчиков/редакторов  Lima_R  29.11.2021  14:43
2 80  Как перевести Your Purchase Price Silver?  Annf25  1.12.2021  14:43

Fwd - DEM JOINTZ - текст песни и перевод слов, слушать онлайн бесплатно

I tell 'em, speak on it

You won’t see the vision if you, sleep on it

Time don’t wait for no man, it just, move forward

No we never stop it, we just, keep going, keep going

Patience is a virtue that we know too well

Keep going, keep going

Patience is a virtue that we know too well

Keep going, keep going

Sacrifice to get it, we been in it, yeah we ten toes

Nothing’s overnight my nigga, yeah we got the memos

Stalling at the runway, I said we just tryna take off

Keep going, keep going

Speak on it

You won’t see the vision if you, sleep on it

Time don’t wait for no man, it just, move forward

No we never stop it, we just, keep going, keep going

Insight, insight, insight alright, I got it, got it

All day, all day, all night, all night, I’m on it, got it

I been, I been, searching, looking, find it, find it

This way, that way, your way, no way around it, round it

Low-key, low-key, like a nigga soft-spoken, spoken

Like a nigga been too on, too on

Nevermind, go too hard, too hard

No, it’s never been too much, too much

You could see the way I moved up, moved up

Keep it moving like a four door, four door

Keep it going 'til they want more, want more

It’s not that complicated

Never stop I need that forward progress baby

Niggas in that rearview lost the concentration

Tryna force the issue, rushed the process maybe

That’s just an observation

All good things take time

You might not know that now

It just might not work out

You’ll find a way somehow

I tell 'em, speak on it

Sleep on it

Move forward

Keep going, keep going

Patience is a virtue that we know too well

Keep going, keep going

Patience is a virtue that we know too well

Keep going, keep going

Sacrifice to get it, we been in it, yeah we ten toes

Nothing’s overnight my nigga, yeah we got the memos

Stalling at the runway, I said we just tryna take off

Keep going, keep going

Speak on it

You won’t see the vision if you, sleep on it

Time don’t wait for no man, it just, move forward

No we never stop it, we just, keep going, keep going

You might not know that now

It just might not work out

You’ll find a way somehow

Перевод песни Fwd

Я говорю им, говори об этом.

Ты не увидишь этого видения, если будешь спать на нем.

Время не ждет никого, просто двигайся вперед,

Нет, мы никогда не остановимся, мы просто, продолжай, продолжай.

Терпение-это добродетель, которую мы слишком хорошо знаем.

Продолжай, продолжай.

Терпение-это добродетель, которую мы слишком хорошо знаем.

Продолжай идти, продолжай

Жертвовать, чтобы получить это, мы были в этом, Да, мы десять пальцев

Ног, ничто не за одну ночь, мой ниггер, да, у нас есть записки,

Которые тянутся на взлетной полосе, я сказал, что мы просто пытаемся взлететь,

Продолжай, продолжай

Говорить об этом.

Ты не увидишь этого видения, если будешь спать на нем.

Время не ждет никого, это просто, двигаться вперед,

Нет, мы никогда не останавливаемся, мы просто, продолжаем идти, продолжаем

Прозрение, прозрение, прозрение, все в порядке, я понял, понял.

Весь день, весь день, всю ночь, всю ночь, я в деле, понял.

Я был, я был, искал, искал, находил, находил.

Так, так, так, так, так, как ты, так, не обойди, не обойди.

Сдержанный, сдержанный, как ниггер, мягко говоря, говорил,

Как ниггер, слишком много говорил.

Не обращай внимания, будь слишком жесток, слишком жесток.

Нет, это никогда не было слишком много, слишком много,

Ты мог видеть, как я двигался,

Двигался, двигался, как четыре двери, четыре двери,

Продолжай, пока они не захотят большего, хотят большего.

Это не так сложно,

Никогда не останавливайся, мне нужно, чтобы прогресс вперед, детка,

Ниггеры в этом зеркале заднего вида потеряли концентрацию,

Пытаются заставить проблему, поспешили с процессом, может

Быть, это просто наблюдение,

Все хорошее требует времени.

Возможно, ты не знаешь, что сейчас

Это может просто не сработать,

Ты найдешь способ как-нибудь.

Я говорю им, говорю об этом,

Сплю об этом.

Двигайся вперед,

Продолжай, продолжай.

Терпение-это добродетель, которую мы слишком хорошо знаем.

Продолжай, продолжай.

Терпение-это добродетель, которую мы слишком хорошо знаем.

Продолжай идти, продолжай

Жертвовать, чтобы получить это, мы были в этом, Да, мы десять пальцев

Ног, ничто не за одну ночь, мой ниггер, да, у нас есть записки,

Которые тянутся на взлетной полосе, я сказал, что мы просто пытаемся взлететь,

Продолжай, продолжай

Говорить об этом.

Ты не увидишь этого видения, если будешь спать на нем.

Время не жди никого, просто двигайся вперед,

Нет, мы никогда не остановимся, мы просто, продолжай идти, продолжай идти,

Ты можешь не знать, что сейчас

Это может не сработать,

Ты найдешь способ как-нибудь.

Tinder: 5 вещей, которые я за неделю сделала в приложении для знакомств

  • Виктория Приседская
  • BBC News Украина

Автор фото, Getty Images

Tinder имеет репутацию сайта для быстрых знакомств и отношений без обязательств. Но что еще ищут пользователи самого популярного в мире сервиса для свиданий?

Мне 41 год, и я впервые зарегистрировалась на Tinder. Похоже на признание анонимных алкоголиков, но доля правды в этом несомненно есть.

Пройдя быструю регистрацию по телефону и указав свое имя и возраст, вы попадаете в мир привлекательных тиндерелл и загорелых подтянутых тиндерфелла.

Выбраться из него обратно будет совсем не просто.

По данным компании, активные пользователи сервиса заходят в приложение в среднем 11 раз в день и проводят в нем до 90 минут.

Революционная технология "свайпа" - если вам нравится фото, вы смахивает его пальцем вправо, если нет - влево, - позволила компании-разработчику Match Group быстро обойти конкурентов.

Хотя на рынке дейтингових сервисов Tinder появился одним из последних, всего за пару лет количество его пользователей перевалило за 50 млн.

Для сравнения, Pokemon Go сделали это за 19 дней, Facebook понадобилось два года, а телефонной связи - целых 75 лет.

Автор фото, Unsplash

"Дуализм нашей жизни, - шутит подруга. - Чтобы сходить налево, надо свайпить вправо".

Но действительно ли этот популярный сервис только о походах налево и сексе без обязательств? Решаю выяснить и, закрыв глаза, нажимаю на огонек.

"Хочешь ярких эмоций?"

С помощью данных о геолокации пользователя приложение помогает искать потенциальных кандидатов рядом.

Впрочем, в настройках можно выбрать расстояние от 2 до 161 км, а также изменить свое текущее местоположение, что дает возможность познакомиться с кем-то из другой точки мира.

Правда, эта последняя функция доступна только в платной версии сервиса.

- Свайпишь? - сочувственно спрашивает коллега на обеденном перерыве.

- Свайплю, - признаюсь я.

Эрих Фромм в "Искусстве любви" писал, что в эпоху капитализма товарно-денежные отношения управляют и романтическими отношениями.

Уверена, он нисколько не удивился бы, если бы увидел современные приложения для знакомств. Tinder - это абсолютный триумф потребительства.

Каждый продает себя как умеет.

"Хочешь забыть о стрессе? Хочешь ярких, приятных эмоций, ты получишь максимально комфортные отношения..." - обещает в своем статусе приятной внешности Антон (имя изменено).

Автор фото, Unsplash

Другие демонстрируют меньшую осведомленность в области холодных продаж и просто цитируют поэтов или пытаются шутить.

Tinder-вселенная бесконечна и разнообразна. Калейдоскопом проносятся мимо "богатый турок", "сапиосексуал", "Отелло", "коренной киевлянин с "красным" дипломом КПИ" и "логико-сенсорный интроверт" (без Гугла и не разобраться).

Почти каждый второй человек указывает свой рост.

Впрочем, в прошлом году Tinder впервые рассказал, что именно нравится его пользователям больше всего.

По данным компании, шансы на "лайк" заметно повышает искренняя улыбка на фото, музыка (в приложении можно разместить ссылку на любимую мелодию с помощью Spotify) и профессия инженера у мужчин.

По женским профессиям четкого рейтинга нет.

Однако известно, что мужчины отдают предпочтение кандидаткам в одежде, чем в бикини.

Тогда как женщины чаще свайпят вправо фото мужчин с красивым обнаженным торсом, чем в официальном костюме.

Выбрав в параметрах большее расстояние, можно несколько часов подряд листать колоду с карточками, разглядывая и искренне удивляясь антропологическому разнообразию вокруг.

И это - первая увлекательная вещь, которую позволяет сделать Tinder.

"PhD - сексапильнее бикини"

Ученые утверждают, что нам нужна только доля секунды, чтобы понять, нравится нам человек или нет, и что этот процесс - совершенно бессознательный.

Я все же верю в свободу воли и потому каждый раз пытаюсь выяснить, что движет моим пальцем влево или вправо.

Впрочем, свобода воли - довольно сомнительный аргумент в эпоху компьютерных алгоритмов.

Автор фото, Getty Images

Поскольку увидеть всех имеющихся пользователей желаемого пола просто физически невозможно, программа пытается самостоятельно вычислить ваших наиболее вероятных кандидатов.

Здесь невольно вспоминаешь серию "Повесь диджея" из "Черного зеркала". Но примерно так Tinder и работает.

Каждому пользователю назначается свой рейтинг привлекательности. Он состоит преимущественно из числа "лайков", которые вы получили. То есть чем больше людей смахивает ваше фото вправо, тем выше ваш рейтинг.

После этого приложение предлагает профили примерно одного с вами уровня "привлекательности".

Tinder также учитывает возраст и географическую локацию, а также данные Spotify и Instagram, которые указывают пользователи.

Конечно, технологии не стоят на месте.

Этой весной компания также объявила, что попытается "считывать" статусы, чтобы подбирать ваших Мистера или Мисс "Тех самых" еще точнее.

Однако я замечаю и другую особенность. Чем больше кандидатов отбраковывают, то хуже становятся следующие. Получается, Tinder предлагает лучшие варианты в начале.

Понимаю, что дольше испытать терпение алгоритма не стоит, и следующему симпатичному кандидату ставлю "лайк".

На экране смартфона вспыхивает "It's a match!" одновременно со скачком дофамина в моем мозгу.

Разговор завязывается сразу, и уже через минуту я получаю комплимент.

"PhD - сексапильнее бикини", - пишет мне мужчина, в анкете которого указано, что он специалист по искусственному интеллекту, и требует подробно изложить выводы моего диссера, в 12-м часу ночи.

Так я узнаю что-то новое о себе. И это - вторая важная вещь, которую можно сделать на Tinder.

"Милые, образованные и независимые"

Уже в первые дни у меня складывается несколько десятков пар. "Поищи в Google, как быть занудой", - дает совет Tinder.

Впрочем, украинские мужчины разговор первыми практически не начинают. А вот иностранцы, наоборот, ведут себя активно и радушно.

Похоже, Tinder - это отличный способ освежить навыки разговорного английского или любого другого языка (третья полезная вещь в моем списке).

После пресловутого высказывания президента о красоте украинских женщин, решаю спросить мнения в Tinder. В анкете профиля задаю вопрос Are Ukrainian women really a brand?

Автор фото, Unspalsh

На вопрос о секс-туризме в Украине подробно отвечает преподаватель экономики из Анкары.

Он признает, что проблема существует, но говорит, что она касается не только Украины. Это общая культура объективации женщины, культура, основанная на сексуальности и внешней привлекательности.

"Я пользуюсь Tinder четыре месяца, - рассказывает он. - Но я не могу свободно общаться с женщинами в моей стране. Я вырос на идеях Просвещения, европейского искусства и литературы. Итак, куда я могу поехать недорого и без визы? Конечно, в Украину".

"Славянская культура очень близка мне, - добавляет он. - Женщины очень милые, образованные и независимые. Это не о сексуальных отношениях, в первую очередь, а о человеческих".

Мое первое Tinder-свидания также с иностранцем - французом.

Мы встречаемся в понедельник в девять утра выпить кофе.

Разговариваем на дикой смеси английского, французского и русского (он четыре года работал в России).

Это не сразу позволяет мне заметить удивительное отсутствие чувства юмора у моего собеседника.

Только заказав капучино и черничный пирог, делаю сразу два "каминг-аута".

Признаюсь, что мне 41 (с перепугу и неуверенности сначала написала в анкете, что 37, но, как оказалось позже, приложение не позволяет редактировать данные об имени и возрасте).

На эту новость он реагирует примерно так, как герой комедии "В джазе только девушки" - тот, который философски замечал - "у каждого свои недостатки".

А вот информация о том, что я на самом деле пишу статью о Tinder, дается моему тиндерфелла несколько сложнее. Но и этот удар он выдерживает стоически и даже в конце предлагает заплатить за меня.

Я категорически отказываюсь, однако интересуюсь, почему он ищет невесту именно в здешних местах.

И получаю знакомый уже ответ - "здесь очень миловидные женщины, образованные и умные, интересные собеседницы...".

Я не выдерживаю и перебиваю: "И мечтают отсюда сбежать?" - "Cela aussi", - соглашается он, озаряя меня безупречной винировой улыбкой.

"В отношениях не заинтересован"

Мое второе свидание - пожалуй, лучший опыт, который произошел со мной во время скитаний по миру виртуальной романтики.

Отправляя в небытие левого свайпа очередных выпускников Стэнфорда на сноубордах, наталкиваюсь на профиль, автор которого ищет моделей для фотосессии.

Да, я знаю, что камера - старый как мир метод пикапа, но соблазн велик, к тому же фотограф пишет, что в отношениях не заинтересован. Через час мы договариваемся о времени, месте и формате съемки.

Он говорит, что у него сложилось с десяток пар, но я "единственная, кто адекватно общается", и добавляет, "надеюсь, ты не мужик".

Я пропускаю мимо ушей откровенный сексизм этой шутки, он признается, что и ребят в принципе тоже готов пофоткать, и мы решаем встретиться.

Автор фото, Dmitry Larin

Мы гуляем томным летним вечером, и я получаю первую в своей жизни профессиональную фотосессию.

Он - штатный фотограф одного СМИ, которому нужно попрактиковать съемку на пленэре, я наконец должна дописать статью о Tinder. Без сомнения, это - идеальный "мэтч".

Это - четвертая вещь, которую я сделала на Tinder.

И ее вариаций - множество. Вы можете вместе сходить на концерт, покататься на байдарках, попробовать мастер-класс по актерскому искусству или воркшоп по нейроменеджменту.

В конце концов, разве это не естественный способ для того, чтобы из дружбы родилось нечто более нежное?

Впрочем, подавляющее большинство мужчин, которые ищут здесь "серьезные отношения", категорически отказываются от общения, если девушка на второй минуте разговора не клянется, что ее намерения также - "в горе и в радости до смерти".

Их можно понять. 1,6 млрд свайпов и 20 млн пар, образующихся на Tinder ежедневно, создают иллюзию бесконечных возможностей, и тратить время на кого-то, кто еще не определился, нет желания.

"Френдзона?"

Именно с этим связано и одно из моих самых больших разочарований на Tinder.

Среди сотни новых пользователей, которых алгоритм подсовывает тебе каждый день, здесь несложно найти фантастических собеседников.

Я узнаю, как создать соцсеть с дополненной реальностью для туристов в Копенгагене, как за минуту определить, что с тобой разговаривает бот, и почему турецкий поэт Кемаль Суре назвал Стамбул "огромным зверем".

В одном из таких разговоров происходит странная химия, кажется, что мы знакомы сто лет, понимаем друг друга с полуслова и можем делиться самыми сокровенными секретами.

Я знаю, что виртуальные отношения обманчивы, но разве качественно созданная иллюзия в наши дни уже давно не стала реальностью?

Возможность найти на Tinder своего настоящего соулмейта - пятая и последняя вещь в моем списке.

Несколько дней я парю в облаках, пока не раздается сакраментальный вопрос о серьезности отношений.

На мое скромное предложение дружбы получаю ответ с кучей смайлов: "А, так это френдзона?"

Автор фото, Getty Images

И через некоторое время меня удаляют из пары. Но видите вы это не сразу - приложение не отправляет сообщений, что вас "отфрендили".

Лишь впоследствии можно заметить, что определенного человека в вашем списке больше нет. Вы больше не сможете отправить ему сообщение или спросить, что произошло, или хотя бы просто увидеть его фото среди других.

Tinder и другие дейтинг-сервисы произвели настоящую революцию в области знакомств и романтических отношений, но отказ и разочарование остаются такими же болезненными.

Как написал в своем статусе один пользователь, Tinder похож на Киндер-сюрприз. "Вы покупаете конфету, надеясь найти в середине что-то интересное, но там только шоколад плохого качества и дешевая безделушка".

"Так и здесь - рассчитываете на что-то серьезное, но в лучшем случае получаете только секс, и то не всегда классный", - написал мужчина.

Но его профиль до сих пор в приложении - похоже, он продолжает свайпить.

Хотите поделиться с нами своими жизненными историями? Напишите о себе на адрес [email protected], и наши журналисты с вами свяжутся.

Корректоры орфографии 9000 1

Время от времени Совет по польскому языку и языковые консультационные центры получают просьбы об упрощении правил польской орфографии. Некоторых беспокоят двойные символы «rz», «ch», для других - «хвосты, тире и точки», то есть диакритические знаки, отличающие букву «ę» от «e», «ł» от «l», «ż». "от" z "," Ó "от" o ".

Одно из этих электронных писем дошло до меня окольным путем. Его автор пишет: «Может быть, польский алфавит можно упростить? Вместо двойных ч / ч , ф / ч ввести одну форму (более короткую)? Я знаю многих иностранцев, которые хотят выучить наш язык, но он для них слишком сложен.Лично я считаю, что и нам такие элементы языка не нужны и только усложняют обучение. Они также не переводятся в устную речь. Везде, где мы идем вперед, мы модернизируемся, мы облегчаем процессы, и язык оставался с этими архаизмами на долгие годы. Я знаю, что эти изменения будут приветствоваться молодыми, пожилыми людьми и теми, для кого это второй язык ».

Я намеренно цитирую фрагмент письма в оригинале, чтобы мы осознали, насколько сложным, непонятным и раздражающим был бы текст без диакритических знаков.Правда, автор извинилась за ошибки, объяснив, что писала «по телефону», но извинения не были приняты. Отправка такого неаккуратного текста кому бы то ни было, независимо от того, где и что он написан, является признаком пренебрежения к получателю (электронное письмо было отправлено в министерство!). Забота о «хвостах» - это проявление уважения как к адресату, так и к родному языку.

Но вернемся к предложению автора, т.е. к идее отказа от цифр, соответствующих одному телефону. Откуда взялись эти два персонажа? В связи с необходимостью адаптации латинского алфавита к звукам польского произношения: стало меньше латинских символов и больше польских звуков.Это не всегда происходило последовательно, о чем мы сегодня не подозреваем, и на самом деле это не имеет большого значения для нас, современников. Позвольте мне упомянуть, что сегодня похожие по звучанию буквы «ó» и «u», «ż» и «rz», «ch» и «h» имели разное произношение. Я до сих пор помню разницу между звонким «h» и глухим «ch» в произношении моей мамы, родившейся в Вильнюсе.

Предположим, однако, что кодификаторы орфографической нормы удовлетворили бы желание корреспондента. Тогда в текстах будут слова «eka», «kożyść», «фермер», «hłud».Будет ли всем понятно, что речь идет о ривер , выгода , прогулке , холода ? Такое «упрощение» привело бы к огромному хаосу (и даже «хаосу»!). Литература, словари перестали бы быть образцом правописания, потому что опубликованные до этой «реформы», они содержали бы только ошибки!

Но разве польская орфография так сложна? Сегодня мы без особого труда читаем и понимаем тексты Яна Кохановского или Игнация Красицкого, далеких от нас веками! Причем поляки довольно быстро усваивают правила использования исторически обоснованных иероглифов: u , - , rz , ż , ch , h , тем более что в случае сомнений они легко могут проверить орфографию конкретное слово в словарях.

Насколько это сложно для иностранцев? Что ж ...

Ewa Kołodziejek

.90 000 18-летний мужчина разгромил «Макларен» в Отвоцке за 1,6 млн злотых. Отец объясняет, как произошло

Mclaren 720S занесло незадолго до полудня в субботу и врезалось в маяк. Хотя все выглядит серьезно, в этом инциденте никто не пострадал. Как выяснилось, за рулем машины находился 18-летний раллийный гонщик Оливер Добровольски . Это одна из машин прокатной компании Select Automotive, принадлежащей его отцу Петру, который также является гонщиком ралли.

В интервью сервису "Sportowe Fakty" Петр Добровольский сказал, что сын находится в кризисной ситуации, но также объяснил свою ошибку. Как он поясняет, Оливье уже ездил на этой машине по гоночной трассе в различных погодных условиях, однако здесь дал понять об отсутствии опыта на дорогах общего пользования .

Тест

: McLaren 720S Spider на польских дорогах доказывает, что суперкары по-прежнему имеют смысл.

Суперкары всегда были игрой на вид. Однако сейчас, как никогда, автомобильная промышленность говорит: проверяю.Открывающиеся вверх двери больше не нужны…

Как объясняет Петр Добровольский, после добавления газа задняя часть автомобиля поскользнулась , передняя часть также потеряла сцепление с дорогой, затем она ударилась о бордюр и, наконец, попала в фонарь. Отец говорит, что Оливер водил машину не безрассудно, но на мокрой дороге управлять этой машиной сложно. По данным полиции, причиной инцидента стала скорость, которая не была приспособлена к сложившимся условиям.

McLaren 720S - это заднеприводная модель с расположенным по центру двигателем V8 с двойным наддувом.Его мощность составляет 720 км . Цена - 1,6 млн злотых, и ремонт поврежденного в Отвоцке, конечно, будет не из дешевых. Были повреждены передний бампер, фонарь, крыло, дверь и подвеска правого переднего колеса.

.90,000 Кубок мира по прыжкам с трамплина: Висла - прорыв для Бяло-Червоних?

Если посмотреть на историю достижений и результатов Бяло-Червониха, холм в Висле - идеальное место для игроков Михала Долежала, чтобы поднять паруса после неудачного начала нового сезона. Неужели так и будет, и поляки откупятся за свои неудачные старты в Руке и Нижнем Тагиле?

Наименее талантливый из трех братьев Сене Превц уже набрал 133 очка чемпионата мира. Для него это достижение всей жизни, хотя в этом сезоне сыграно всего четыре соревнования.Это ставит словенку на седьмое место в общем зачете. Семь польских прыгунов заработали такое же количество очков! В том числе трое чемпионов мира: Петр Жила, Давид Кубацкий и Камил Стох. Меньше всего возражений против трехкратной олимпийской чемпионки.

- Не думал, что это будет так плохо, - признал тренер Михал Долежал. Польша опустилась на седьмую позицию в командном зачете Кубка Наций. В прошлом сезоне она была в нем второй, в 2017 и 2019 годах побеждала.Болельщики не привыкли к таким плохим результатам, как в Руке и Нижнем Тагиле. Долежал не ищет легкого алиби, не признает, что полякам всегда было трудно прыгать с трамплина в Финляндии и России.

Нет сомнений, что на этот раз с формой польских прыгунов что-то не так. Кубацкий набрал 20 очков за четыре старта. Она прожила всего семь человек. Сенсационно в прошлом сезоне, Анджей Стенкала набрал 1 очко! Похоже на мрачную шутку.

Долежал, а также Адам Малыш и президент PZN Аполониуш Тайнер обеспечивают хорошую подготовку польских прыгунов к олимпийскому сезону.По проверенным методам, которые работают годами в сотрудничестве с австрийским физиологом Харальдом Перничем. Так что же происходит? Тайнер поясняет, что поляки упорно тренировались, они не сдавались даже перед чемпионатом мира и теперь им не хватает свежести. Однако они вернут его в последующих соревнованиях.

В четверг в Висле Долежал вывел команду на дополнительную тренировку на холм. Каждый участник сделал три попытки. - Речь шла о том, чтобы поймать чувство на пороге, - сказал Интериа тренер.Все надеются, что в Висле, на известном месте, поляки сделают шаг вперед.

Подробнее на Interia.pl

Interia.pl

Перейти на Polsatsport.pl Ваш браузер не поддерживает видеоплеер ...

PolsatSport.pl для телефонов с Android и iOS!

Самая свежая информация и новости в реальном времени, где бы вы ни находились.

.90 000 Как несчастные случаи меняют мир. Отрывок из «Историй катастроф»

Американские дороги на мили идут прямо. Для водителя они смертельно скучны, потому что с ними на самом деле ничего не происходит - кроме самого вождения и обычно плохого дорожного покрытия. В большинстве штатов США давно действуют жесткие ограничения скорости, но можно упростить то, что вы можете проехать 90-110 км / ч, не беспокоясь о билетах и ​​не гоняясь за машиной местного шерифа. Это не много. Было ли вождение в конце 1960-х годов менее динамичным, чем сегодня? Уж точно не в Америке, потому что там у машин «всегда» много цилиндров (шесть - норма, восемь никого не удивляют), и в то же время они крепкие.Когда на Старом континенте были вагоны на 60-80 лошадиных сил, в распоряжении американцев было 200, 300 и 400 лошадей. Такие агрегаты устанавливали на мощные и очень удобные машины, хотя им не хватало точности управления. Что это значит? У больших «круизеров» была мягкая подвеска, чтобы справляться с выбоинами, и системы рулевого управления, которые хорошо работали с грузовиками, но не гарантировали быстрой реакции на движение обода рулевого колеса (в просторечии «колесо»).

Американский Додж, Шевроле или Форд Форды выглядят очень величественно, но плохо управляются... Особенно на поворотах, но и торможение - из-за веса, превышающего две или даже три тонны - не доставляет удовольствия. Уместно было бы написать прямо: «На нем нельзя ездить, а самое большее гулять». С другой стороны, если водитель будет вести такую ​​машину спокойно и уверенно, о пересечении континента не может быть и речи. Большие седаны полвека назад стали новаторскими автомобилями, покорившими Дикий Запад. Можно упаковать всю семью, собак, чемоданы и отправиться на другой конец континента.Кадры из фильма, когда американская семья приезжает на машине после целого дня в машине, чтобы переночевать в придорожном мотеле, не преувеличены.

Читайте также: Американская мечта.Водитель TIR честно о работе в Польше и США

(...)

Представьте себе типичную бетонную дорогу, ведущую из Нового Орлеана в Сент-Луис.Это 1967 год. Жаркий июнь не позволяет никому жить в мире ... Все в поту, в унынии, в ярости. Но они должны как-то вписаться - жара в Луизиане - это повседневная реальность. Надо ждать полудня. Где-то под потолком вентиляторы лениво перемешивают воздух, а кондиционирование в то время здесь еще в новинку. В среду, двадцать восьмого, в ресторане Gus Stevens Supper Club недалеко от Билокси состоится шоу Джейн Мэнсфилд. Это последний из вечеров, на который был подписан контракт. Звезда могла отдохнуть.Возможно, Билокси не была Майами-Бич или Лас-Вегасом, но она нашла квартиру на уровне и могла ненадолго отдохнуть от повседневной калифорнийской жизни.

(...)

Звезда прилетела на Билокси, авиабазу Кислер. Таков был план - она ​​смогла навестить раненых солдат, которых привезли сюда из Вьетнама.Там она ехала на желтом «роллс-ройсе», который она сама взяла напрокат и ехала сама - потому что у Сэма Броуди была гипсовая повязка. Они планировали вернуться в Новый Орлеан на этой машине, но ранее владелец лимузина расторг договор, когда выяснилось, что чек Мэнсфилда ... неоплачен. Она была в ярости, потому что осталась на льду и, что еще хуже, без транспорта. Между тем, утром 29 июня в календаре звезды было выступление на телевидении WDSU и вечерняя развлекательная линия «В полдень». Она знала, что его будут смотреть сотни, и что шоу-бизнес имеет свои права.Поскольку они приглашают перед камерой и ждут хорошего продвижения по службе, она хотела преуспеть в Новом Орлеане. Мэнсфилд предполагал, что она сядет в машину и будет в следующем отеле через два часа после своего последнего выступления с Гасом Стивенсом. Он проспал утомительную ночь, позавтракал, а потом оказался на телеэкране - план был довольно хорош. Злополучный чек нарушил ее планы. Стивенс не хотел брать ей машину напрокат. В конце концов, она каким-то образом попросила его нанять шофера на несколько часов, чтобы отвезти толпу в Мэнсфилде на машине жены ресторатора, Buick Electra 225 оливкового цвета.

Фото: Сергей Коль / Shutterstock.ком Бьюик Электра 225

(...)

Харрисон направился в Новый Орлеан. Сначала он не чувствовал усталости. Больше похоже на азарт. В конце концов, это была просто Джейн Мэнсфилд! Многие мужчины умерли бы за такую ​​работу.Она села рядом с ней, так что Ронни, должно быть, отвел взгляд от руля и внимательно следил за ней. У Джейн было уже три брака, но ей было всего 34 года. Она была пухленькой, но все же имела отличную фигуру. Влюблен он или нет, но Ронни Б. Харрисон с любопытством смотрел на соблазнительные губы актрисы. Ничего особенного не предвидится. Двигатель работал ровно, а молодой водитель - быстро. У него была возможность вскоре вернуться к девушке и проспать часть ночи в собственной постели. «Бьюик» казался настоящим крейсером, рассекающим волны темной морской бухты прямо за окнами.

Около 2.25 Ронни Б. Харрисон врезался в полуприцеп 18-колесного большого грузовика на прямой дороге. Он, вероятно, не заметил, что она просто замедлилась и остановилась.Почему? Потому что на дороге №90 было распылено средство, чтобы остановить нашествие комаров. Болотистые заросли и тростник заросли миллиардами. Ночь была ясной и, вероятно, безветренной, поэтому брызги ядохимикатов долго не падали, создавая белый туман над асфальтом. Вы буквально ничего не могли увидеть! Любой здравомыслящий водитель с небольшим опытом снизит скорость и будет вести машину гораздо осторожнее.

Читайте также: Джереми Кларксон: чем рискует купаться в кадке с сырой нефтью?

Трудно сказать, кто был за рулем 20-летнего Ронни Б.Харрисон. Может сумасшедших сколько? Может быть, спокойный и скучный до боли? А может, он просто заснул на долю секунды? Ведь у организма есть свои права ... Трудно его упрекнуть в том, что он не заметил (или слишком поздно) светофор большого грузовика. Он даже имел на это право. Если он ехал со светофором, что является нормальным по ночам, а многие так и поступают, на практике он видел облако пестицидов как ... молоко. Именно такое впечатление производит каждый, кто не переключал ближний свет фар на так называемый ближний свет в тумане.длинные - видимость всегда плохая.

По более поздним оценкам, Харрисон ехал со скоростью 120–130 км / ч. Видимо, чуть выше среднего, то есть без бравады.Однако не было даже минимального шанса на торможение. Это также объясняет огромную силу, с которой мальчик ударил своим бьюиком заднюю часть грузовика. Джейн Мэнсфилд приписывают ироническую цитату: «Если вы хотите сделать что-то не так, сделайте все возможное, чтобы сделать это на ура». Эта авария была просто «взрывом». Большой «бьюик», тяжелый, трудно остановить, врезался глубоко под рамой прицепа. Мощный и прочный, поэтому он срубил обе передние стойки за доли секунды. В то время, конечно, идея заключалась в создании максимально безопасных автомобилей, но в Buick силуэт был на первом месте.Седан должен был быть модным, а это означало тонкие передние стойки и символические средние, чтобы не портить линию окон. Учитывая размер передних стоек в то время, не было никакого способа остановить инерцию - рама прицепа буквально скальпировала машину, убив всех троих на переднем сиденье и двух собак.

Когда приехала ГИБДД, перед полицейскими предстало страшное зрелище.Машина была похожа на жестяную банку на колесах, у которой сорвана крышка. Справа моторный отсек был раздавлен - крылья и колесные арки перевернуты вверх, заканчиваясь острыми заусенцами у лобового стекла. Вернее, на том месте, где когда-то было прикреплено стекло. Справа, под разорванным зеркалом заднего вида, на золотой краске было большое пятно крови. Невероятно, что кто-то смог выжить в таком столкновении. И все же детям, заснувшим в спине, очень повезло.Восьмилетний Микки, шестилетний Золтан и Мари-Маришка (тогда ей было три года) получили травмы, к счастью, несерьезные. Две собаки тоже выжили, но были потрясены. На видео, документирующем действия полиции, вы можете увидеть, как офицер аккуратно заправляет собаку на передние сиденья полицейской машины. Потом беспомощно смотрит на свои руки - не знает, чем их протереть. У собаки, вероятно, была кровь или моча от страха.

(...)

Фотография: Shutterstock Американский грузовик

После Джейн Мэнсфилд осталось кое-что более ощутимое - бампер, но это ни в коем случае не пережиток Buick! Стоит взглянуть на прицепы, которые буксируют большие грузовики.Специальные бамперы используются для защиты от наезда под транспорт. Их называют Т-образными перекладинами из-за их формы, напоминающей перевернутые Т-образные стержни. В просторечии это все еще «бампер Мэнсфилда». Приказ об их использовании действует только с 1998 года, т.е. вступил в силу только через 20 лет после гибели секс-бомбы.

.

Warta должна забить и набрать очки, если мы хотим продержаться [ИНТЕРВЬЮ]

Три недели назад громко шло о поступлении в «Экстракласа» самого молодого польского тренера с лицензией UEFA Pro. За плечами Давида Шульчека свои первые два матча на высшем уровне. Пока что его команда не набрала и не набрала очков. Однако молодой тренер считает, что это изменится в любой момент. В третьем эпизоде ​​серии «Тренировки - это здорово» с букмекерской конторой Superbet он объясняет тактические сложности матчей между Вартой Познанью и Вислой Плоцком и воскресным дерби с Лехом Познанем.

Две игры в Экстракласе для Господа. Какие твои первые впечатления?

Я должен различать две вещи. Вступление в клуб и моя работа, а также впечатления после встреч. Последние, к сожалению, отрицательны, поскольку работа тренеров подтверждается результатами. Все, что рядом, не имеет большого значения. К сожалению, мы проиграли две игры. Знаю, что в воскресенье мы играли с очень сильным Лехом. Раньше мы проиграли бы одну игру Висле Плоцку, с которой проиграли бы один из следующих 10 таких матчей.Так выглядела встреча.

А как выглядит весь нимб?

Ощущения очень положительные. При первом входе в клуб видимых проблем не было, не считая того, что Варта забивает мало голов. В гардеробе ничего плохого не происходит. У входа в клуб тихо, и мне нравится работать с людьми. Организационно на хорошем уровне, поэтому первое впечатление - плюс.

Вернемся к спорту.

Самое главное еще не удалось поправить.Что Варта начнет забивать голы. Проблема с этим практически с начала сезона. Вот почему я пришел исправить это. Но для этого нам нужно создавать больше возможностей, делать больше бросков, улучшать ожидаемые голы и забивать голы. Первые три вещи уже реализованы, но мяч должен попасть в сетку. Возможности и броски есть - xG за две игры получился неплохим - 3,7, но мы не забили ни одного гола. Он покончил с собой вместе с Вислой Плоцк.

Пока нам удалось улучшить игру между штрафными площадками, но сейчас нам нужно улучшить этот важнейший момент.После матча с «Вислой Краков» нельзя сказать, что мы снова сыграли хорошо, но мы проиграли. Мы должны забивать голы, и мы работали над этим с самого начала и будем продолжать работать над этим. На этой неделе я немного поменяю тренировочные акценты. Я доволен командной тактикой, но мне нужно больше технико-тактических вещей. Это будет более приятная форма для игроков, но мы не проиграем в ней как команда.

Вы упомянули два совершенно разных матча. Вы играли с Вислой Плоцком, а с Лехом довольно глубокая защита.Комментирующий матч на TVP Sport Роберт Подолинский заметил, что вы сказали на пресс-конференции, то есть о расстановке 1-6-3-1. Получилось хорошо, особенно в первом тайме.

Варта может сыграть большинство матчей в Экстракласе, как и Висла Плоцк. Однако в Экстракласе есть несколько команд, против которых нам придется сосредоточиться на слабой защите. Высокое качество соперников нападающих в игре 1 на 1 не позволяет нам вовлекать больше наших игроков в высокий прессинг.Мы также хотим избежать ситуаций, когда противник ринется в контратаку 4 на 5. С бумажной точки зрения это кажется нормальным. Однако, когда такая Ба Луа проходит мимо одного игрока, возникают проблемы. Вот почему нам пришлось поставить такие преграды. Тогда подопечные Колехорца, даже выиграв поединки, на небольшом пространстве окружали себя множеством соперников. В общем, мы разрешили только отыгрыши мяча, в основном из тех секторов, где редко бывают голевые передачи.

Что касается развития, мы будем двигаться в том направлении, в которое мы играли с Вислой Плоцком.Иногда мы вернемся к этой идее с Лехом. Однако не 1-6-3-1. Я бы все равно вернулся в Лех. Я не знаю, есть ли сегодня в «Экстракласе» вторая команда, которая в момент позиционной атаки способна пробежать в штрафную с семью игроками. Лех, ведя мяч в одном секторе поля, атакует штрафную с тремя-четырьмя игроками. Достаточно нескольких секунд, чтобы сместить игру и в сторону, а затем еще три-четыре атаки в штрафную. Контролировать такие пробежки очень сложно, поэтому мы позиционировали себя именно так.Все оказалось правдой.

После стандартных положений пропустили

мяча. Темп с первого на третий, когда не удалось перегруппироваться, как и Лех. Их стопоры остались в нашей штрафной, как и наши нападающие. Однако я бы предпочел ситуации, когда обе эти группы находятся в другой штрафной площади. Тогда у нас больше шансов забить гол, и вот как мы проиграли.

Заметен переход Матеуша Купчака к линии обороны при обороне.Чаще всего его помещали между правым центральным защитником Робертом Ивановым и правым качелем Яном Гжесиком. Это добавление еще одного игрока к линии защиты или нейтрализация левого фланга Леха, читай: Якуб Камински?

Дело не только в Каминском. Известно, что он и Ба Луа любят играть за обе стороны. Идея заключалась в том, чтобы наши игроки не проигрывали поединки 1 на 1. Любые поражения заканчивались натиском на нашего следующего игрока.Кроме того, три помощника закрыли возможность прохождения так называемого зона помощи. Леху приходилось либо выводить мяч, либо центрировать мяч. Мы хотели кроссы на расстоянии, потому что у нас хорошая физическая подготовка, и Леху, кроме Исхака, было сложно что-то с этим делать.

Я рассчитывал, что позже тренер Скорня либо введет второго нападающего, либо забросит Саламона в нашу штрафную, и это тоже случилось. Возможно, Лех не изменил состав, но он поменял игроков - остались Квеквескири и Милич.Тогда мы хотели использовать контратаки, и было несколько раз, когда мы могли лучше выйти.

Еще не вернусь. Мы тренировали уход Купчака. Мы знали, что с нашими 5-4-1, «10» и ротацией вингеров в «Лехе» у нас могли быть большие проблемы. Раньше Лех расправлялся со своими соперниками 5-4-1 / 5-3-2, и уже в матче с Пястом я видел, что они все лучше и лучше работают против такого состава. Это могло просто не дать нам того эффекта, который Stal Mielec имел против них.Коледжорз пошел на два шага вперед против такой постановки.

В первых двух партиях я заметил очень высокие и широкие раскачивающиеся маятники. Это также дало Джейсону Папо больше места в полузащите.

Джейсон - игрок, который может изменить мир к лучшему. Вот почему мы хотим, чтобы он был в таком месте, где его можно было бы отдать ему с обеих сторон. С другой стороны, Гжесик и Келб - игроки, которые могут многое сделать в атаке.

Оба оказались в штрафной при положении 15.минут против Леха, когда вы должны были забить 1: 0.

Они участвовали в его создании. Гржесик очень хорошо развернулся со своим соперником на спине, и Келб замкнул ее. У меня есть комфорт, что я испытал такие секундомеры, как Иванов, Тралка и Шимонович. Кроме того, Купчак и Копчинский в центре поля, поэтому маятник может чувствовать больше свободы и идти вперед, пользуясь этим. Эта установка предназначена не для того, чтобы скрыть свои недостатки, а, скорее, для того, чтобы подчеркнуть преимущества игры вперед. Варта должен забивать и забивать, если мы хотим держаться.

Когда мы говорили в январе, вы сказали, что идеальное время для прихода к власти в команде - середина декабря. Некоторое время на анализ, затем период подготовки. Теперь господин Варта взял верх во время раунда. Однако какое-то время во время национального перерыва можно было поработать спокойно. Однако есть еще матчи и нужно набирать очки.

Еще я сказал, что за две недели в защите можно сделать очень много. Здесь вы можете видеть, что мы немного по-другому работаем с прессингом и разрушением.К сожалению, после стандартных положений мы пропустили три мяча. Быстрые машины с Вислой Плоцком, теперь две с Лехом. Четвертый отдали сопернику.

Меня устраивает наша структура, когда соперник играет позиционную атаку или когда мы начинаем прессинг. Это безбольная штука, которую можно установить очень быстро. Тренировались перед Вислой. Сейчас мы немного по-другому тренировались перед дерби, но этого хватило, чтобы хорошо сработаться с Лехом.

«В Экстракласе есть клубы, где сгорел бы 30-летний польский тренер».Прочтите наше интервью с Давидом Шульчеком 10 месяцев назад!

Атака требует больше времени.

Наступательную структуру можно настроить хорошо, но нужно больше времени, чтобы развить некоторые автоматизмы. Я считаю, что 4-5 недель - это время, когда можно ожидать первых результатов. В день матча с Вислой Краков я завершу четвертую неделю работы и надеюсь, что эффект будет заметен.

В более широкой перспективе, можем ли мы ожидать большего эффекта после зимних каникул?

Думаю, да.Надеюсь, что мы сможем набрать очки в следующих матчах и выиграем до Рождества. Тогда у него будут руки и ноги. Игроки захотят остаться, может быть, сделаем два трансфера, чтобы еще больше укрепиться. Во-первых, у меня будет перспектива двухмесячной работы. Мне не придется беспокоиться о том, что игра вот-вот выйдет, и игрок должен быть для нее свежим. Я буду проводить больше времени на поле. Разница в том, чтобы подготовить команду четыре недели, но играли товарищеские матчи, и четыре недели - матчи лиги.

Никто так не смотрит на результаты спарринга. Вы можете объясниться по ним.

Это даже не объяснение. За день до спарринга я могу провести две тренировки или продлить их, сделать еще кое-что. За день или два до матча чемпионата мы не можем знать, сколько еще нужно работать. Спортсмен должен выйти на 100% физически готовым.

Беседовал Рафал Шишка

***

Предыдущие серии цикла:

Павел Грыцманн: Мы хотим сотрудничать с университетами

Дети, родители которых не интересуются футболом, имеют наибольшие шансы сделать карьеру

.

Вредна ли ваша обувь для вашего здоровья?

90% из нас в какой-то момент жизни испытывают боли в спине, и 14 процентов. страдают остеоартритом, который может поражать лодыжки и колени. Мы часто относим эти боли к старости, травмам и целому дню сидения за столом. Но действительно ли наша обувь является источником некоторых из этих проблем?

Иллюстративное фото / Shutterstock

«Неправильно подобранная обувь может навредить не только ногам. Они также могут оказывать неблагоприятное воздействие на все тело ». - BBC.com сообщает в статье« Не повреждает ли моя обувь мое тело? ».

Обувь на высоком каблуке - это обувь с наихудшей репутацией . Они могут отрицательно повлиять на скелетно-мышечной системы , нарушая биомеханику ее элементов, что приводит к изменению положения тела . На развитие боли также может влиять наклон тела . Бедра слегка прогнуты вперед и назад . Для этого требуется повышение мышечного тонуса и больше энергии для поддержания баланса.

/ Shutterstock

При ношении каблуков ориентируется на переднюю часть стопы - На среднюю часть стопы и пальцы .Это может привести к образованию так называемого молоток пальца , где три средних пальца соединяются друг с другом. Лодыжка приподнята , что удерживает икроножную мышцу в напряженном положении. Пятки вызывают сжатие и укорочение ахиллова сухожилия.

/ Shutterstock

Обувь на плоской подошве обычно считается безопасной альтернативой каблуку.Но мода на суперплоские балетки и шлепанцы может быть для нас ничуть не хуже. При очень плоской обуви основное внимание уделяется каблуку . Это может привести к тому, что мышцы стоп и сухожилий будут компенсировать дополнительную поддержку, что может привести к состоянию под названием подошвенный фасциит . Это воспаленная ткань между пяткой и сводом ступни .

/ Shutterstock

Тесная обувь может оказывать давление на переднюю часть стопы и пальцы ног, что может привести к мозолям, мозолям и большим пальцам стопы .

Покупайте обувь по размеру, а не по размеру, указанному на упаковке. И обязательно меряйте ногу в магазине!

Маргарет Даббс, генеральный директор и основатель лондонских клиник для ног, советует Vogue.travel носить обувь на каблуке 3 см, чтобы обеспечить наилучшее состояние стопы.

Главное - правильно выбрать каблук. Лучше трехсантиметровый каблук, чем его отсутствие. - объясняет эксперт .Когда вы носите каблуки, ахиллово сухожилие укорачивается, но без каблука оно будет удлинено. В идеале вам следует избегать обеих крайностей. Что касается лимита времени, я бы сказал, что он не должен превышать четырех часов - подчеркнуто , .

Вы посещаете стоматолога и офтальмолога для профилактики, и не думаете о своих ногах, пока они не начнут болеть. - говорит Маргарет Даббс .

.

Прыжки с трамплина - физика помогает прыгунам совершать идеальные прыжки. Интервью с учеными

Премиум

Разгон, выход с порога, полет, посадка. Чистая физика

Сначала нужно быть как ракета, а затем - после идеального прорыва на пороге - принять форму, похожую на крыло самолета. Наконец, все, что вам нужно сделать, это подготовить колени к приземлению, которое было бы болезненным для любого другого человека. Ученые увлекаются прыжками.В интервью tvn24.pl они объясняют, почему и что определяет успех.

Прыгун должен оттолкнуться от балки, выйти на взлет, выпрыгнуть и улететь как можно дальше. Для многих болельщиков это в первую очередь борьба со страхом - ведь каждый, кто хоть раз побывал на трамплине, знает, как заморозить вид, наблюдаемый прыгунами перед стартом.

Однако для физиков прыжки увлекательны по другой причине - как они объясняют, постоянное стремление к совершенству. Ошибки - даже самые мелкие и часто невидимые для неподготовленного глаза - отделяют лучшее от всего остального. Профессор Павел Ковальчик с факультета физики и прикладной информатики Лодзинского университета и доктор-инженер Кшиштоф Войцеховский из Центра преподавания математики и физики из Лодзинского технологического университета рассказывают об этих деталях.Они подчеркивают, что прыжки с трамплина - это дисциплина, требующая огромной силы (то есть способности высвобождать высокую энергию за короткое время), точности, смелости и ... способности ориентироваться в воздухе.

Ученые поэтапно рассказали о рецепте успеха в спорте, который поляки любят более 20 лет.

Take-up

- Чтобы понять, что происходит с прыгуном во время разбега, нам нужно вернуться к школьному материалу.Точнее - в наклонную плоскость, - указывает профессор Ковальчик.

На участника действует сила тяжести, благодаря которой прыгун набирает скорость.

- Когда-то было такое игровое шоу. Стартеры получали большую сумму в начале игры, а затем - вместе с каждым неправильным ответом - постепенно ее теряли. Чем меньше ошибок кто-то сделает, тем больше награды он покинет студию. Это похоже на прыжки, - добавляет д-р Eng. Войцеховский.

Как сопротивление воздуха влияет на скорость на прогутвн24.pl

Максимальная скорость, которую может достичь участник, получается путем умножения синуса угла наклона на ускорение силы тяжести, а затем на время перемычки на бегу (если кто-то побледнел во время чтения этого предложения, мы успокойтесь - никаких формул и уравнений в этом тексте больше не будет).

- Конкурент влияет на сопротивление. Чем они меньше, тем быстрее доберется до конкурента. Прыгун снижает трение лыж о желоб на холме и снижает сопротивление воздуха, - говорит профессор Павел Ковальчик.

Команды борются с трением лыж, смазывая лыжи веществами, которые делают их очень скользкими (мы вернемся к этому позже).Участник сам должен бороться с сопротивлением воздуха.

- Должен быть как ракета во время налета. Его положение должно быть максимально аэродинамичным. Что это значит? То, что он должен быть закруглен, чтобы воздух не задерживался на нем, а обтекал его, - объясняет профессор Лодзинского университета. Он объясняет, что речь идет об уменьшении площади атаки конкурента в воздухе. Тело джемпера действует как тормозная ткань - поэтому чем меньше поверхность контактирует с воздухом, тем лучше.

Читать неограниченно

Получить доступ к этой статье и другому специальному содержимому.Бесплатно

Авторизуйтесь и узнайте больше или зарегистрируйтесь

.

Смотрите также

     ico 3M  ico armolan  ico suntek  ico llumar ico nexfil ico suncontrol jj rrmt aswf